CMV-Kir2.1-pA-CMV-mRFP-pA(AV39)
(Plasmid
#117856)
-
PurposeThis plasmid expresses Kir2.1 along with fluorescent marker RFP under the control of CMV promoter. The vector also supports the construction of adenovirus using ADeasy system.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117856 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneRedTrackCMV
-
Backbone manufacturerJames Bamburg lab
- Backbone size w/o insert (bp) 9057
- Total vector size (bp) 10508
-
Vector typeMammalian Expression, Adenoviral
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKir2.1
-
Alt nameinward-rectifier potassium ion channel 2.1
-
Alt nameKcnj2
-
SpeciesM. musculus (mouse)
-
Entrez GeneKcnj2 (a.k.a. IRK1, Kcnf1, Kir2.1)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CACAATGCTTCCATCAAACG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-Kir2.1-pA-CMV-mRFP-pA(AV39) was a gift from C. Ron Yu (Addgene plasmid # 117856 ; http://n2t.net/addgene:117856 ; RRID:Addgene_117856) -
For your References section:
A Population of Navigator Neurons Is Essential for Olfactory Map Formation during the Critical Period. Wu Y, Ma L, Duyck K, Long CC, Moran A, Scheerer H, Blanck J, Peak A, Box A, Perera A, Yu CR. Neuron. 2018 Dec 5;100(5):1066-1082.e6. doi: 10.1016/j.neuron.2018.09.051. Epub 2018 Oct 25. 10.1016/j.neuron.2018.09.051 PubMed 30482691