Skip to main content
Addgene

Kif1A(1-489)-DHFR-myc
(Plasmid #117833)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117833 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1(+)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kif1A (1-489)
  • Alt name
    Kinesin-3 motor domain
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1467
  • Mutation
    only aa 1-489 (motor domain)
  • GenBank ID
    XP_006529221.1
  • Entrez Gene
    Kif1a (a.k.a. A, ATSV, C630002N23Rik, Gm1626, Kn, Kns1)
  • Promoter CMV
  • Tags / Fusion Proteins
    • DHFR (C terminal on insert)
    • myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CMV_fwd (CGCAAATGGGCGGTAGGCGTG)
  • 3′ sequencing primer BGH_rev (TAGAAGGCACAGTCGAGG)
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene NGS results found S33N and E170G variants in Kif1A compared to the NCBI reference [XP_006529221.1]. These variants do not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Kif1A(1-489)-DHFR-myc was a gift from Thomas Schwarz (Addgene plasmid # 117833 ; http://n2t.net/addgene:117833 ; RRID:Addgene_117833)

  • For your References section:

    The light-sensitive dimerizer zapalog reveals distinct modes of immobilization for axonal mitochondria. Gutnick A, Banghart MR, West ER, Schwarz TL. Nat Cell Biol. 2019 Jun;21(6):768-777. doi: 10.1038/s41556-019-0317-2. Epub 2019 May 6. 10.1038/s41556-019-0317-2 PubMed 31061466
Related items:
Commonly requested with: