Skip to main content
Addgene

pGTag-NLS-TagRFP-B-actin
(Plasmid #117806)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117806 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pK
  • Backbone manufacturer
    Karl J. Clark
  • Backbone size w/o insert (bp) 2958
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TagRFP
  • Alt name
    RFP
  • Species
    H. sapiens (human), D. rerio (zebrafish)
  • Insert Size (bp)
    1843
  • Tag / Fusion Protein
    • NLS (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCATGGATGTTTTCCCAGTC
  • 3′ sequencing primer atggctcataacaccccttg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Online tools and cloning help available at <www.genesculpt.org/gtaghd/>. May work in additional species beyond those listed. Please visit https://www.biorxiv.org/content/10.1101/431627v2 for bioRxiv preprint. Please note that some discrepancies were found between Addgene's quality control result and the depositor's provided sequence. The depositor noted that these discrepancies do NOT affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGTag-NLS-TagRFP-B-actin was a gift from Jeffrey Essner (Addgene plasmid # 117806 ; http://n2t.net/addgene:117806 ; RRID:Addgene_117806)
  • For your References section:

    Efficient targeted integration directed by short homology in zebrafish and mammalian cells. Wierson WA, Welker JM, Almeida MP, Mann CM, Webster DA, Torrie ME, Weiss TJ, Kambakam S, Vollbrecht MK, Lan M, McKeighan KC, Levey J, Ming Z, Wehmeier A, Mikelson CS, Haltom JA, Kwan KM, Chien CB, Balciunas D, Ekker SC, Clark KJ, Webber BR, Moriarity BS, Solin SL, Carlson DF, Dobbs DL, McGrail M, Essner J. Elife. 2020 May 15;9. pii: 53968. doi: 10.7554/eLife.53968. 10.7554/eLife.53968 PubMed 32412410