pPRISM-Fuse-cmlc2-mRFP
(Plasmid
#117787)
-
PurposeDonor for precise CRISPR directed genomic integration using the GeneWeld method
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117787 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepK
-
Backbone manufacturerKarl J. Clark
- Backbone size w/o insert (bp) 2856
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemRFP
-
Alt nameRFP
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)3922
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aaaagcaagaaagaaaactagagtgg
- 3′ sequencing primer atggctcataacaccccttg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Secondary gene is a cardiac-myosin-light-chain-2 promoter driving NLS-mRFP. Online tools and cloning help available at <www.genesculpt.org/gtaghd/>. May work in additional species beyond those listed. Please note that some discrepancies were found between Addgene's quality control result and the depositor's provided sequence. The depositor noted that these discrepancies do NOT affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPRISM-Fuse-cmlc2-mRFP was a gift from Jeffrey Essner (Addgene plasmid # 117787 ; http://n2t.net/addgene:117787 ; RRID:Addgene_117787) -
For your References section:
Efficient targeted integration directed by short homology in zebrafish and mammalian cells. Wierson WA, Welker JM, Almeida MP, Mann CM, Webster DA, Torrie ME, Weiss TJ, Kambakam S, Vollbrecht MK, Lan M, McKeighan KC, Levey J, Ming Z, Wehmeier A, Mikelson CS, Haltom JA, Kwan KM, Chien CB, Balciunas D, Ekker SC, Clark KJ, Webber BR, Moriarity BS, Solin SL, Carlson DF, Dobbs DL, McGrail M, Essner J. Elife. 2020 May 15;9. pii: 53968. doi: 10.7554/eLife.53968. 10.7554/eLife.53968 PubMed 32412410