pPRISM-gal4-VP16-gcry-mRFP
(Plasmid #117778)

• Purpose: Donor for precise CRISPR directed genomic integration using the GeneWeld method
• Depositing Lab: Jeffrey Essner
• Publication: Wierson et al Elife. 2020 May 15;9. pii: 53968. doi: 10.7554/eLife.53968.

Backbone

• Vector backbone: pK
• Backbone manufacturer: Karl J. Clark
• Backbone size w/o insert (bp): 2856
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: gal4/VP16
• Species: D. rerio (zebrafish)
• Insert Size (bp): 4051

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: aaaagcaagaaagaaaactagagtgg
• 3′ sequencing primer: atggctcataacaccccttg

Resource Information

• Supplemental Documents:
  • pPRISM-Gal4-VP16-gcry-mRFP_(091118).gb
• Addgene Notes:
  • Addgene Diagnostic Digest

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Secondary gene is a gamma-crystalin promoter driving NLS-mRFP. Online tools and cloning help available at <www.genesculpt.org/gtaghd/>. gal4-VP16 should be used in conjunction with a UAS expression line. May work in additional species beyond those listed. Please note that some discrepancies were found between Addgene's quality control result and the depositor's provided sequence. The depositor noted that these discrepancies do NOT affect plasmid function.

This plasmid has been found exist in our stock as a multimer. Plasmid multimerization often does not impact plasmid function, but may reduce transformation efficiencies. You may need to screen multiple colonies to isolate the monomeric version of this plasmid. If you still have trouble isolating the monomeric version, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid.