pPRISM-Stop-cmlc2-TagBFP
(Plasmid #117774)

• Purpose: Donor for precise CRISPR directed genomic integration using the GeneWeld method
• Depositing Lab: Jeffrey Essner
• Publication: Wierson et al Elife. 2020 May 15;9. pii: 53968. doi: 10.7554/eLife.53968.

Backbone

• Vector backbone: pK
• Backbone manufacturer: Karl J. Clark
• Backbone size w/o insert (bp): 2856
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 3x3 Stop sequence
• Alt name: Stop
• Species: D. rerio (zebrafish)
• Insert Size (bp): 3276

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: aaaagcaagaaagaaaactagagtgg
• 3′ sequencing primer: atggctcataacaccccttg

Resource Information

• Supplemental Documents:
  • pPRISM-Stop-cmlc2-TagBFP_(091118).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Secondary gene is a cardiac-myosin-light-chain-2 promoter driving NLS-TagBFP. Online tools and cloning help available at <www.genesculpt.org/gtaghd/>. May work in additional species beyond those listed. Please note that some discrepancies were found between Addgene's quality control result and the depositor's provided sequence. The depositor noted that these discrepancies do NOT affect plasmid function.