Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPRISM-Stop-gcry-mRFP
(Plasmid #117772)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117772 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pK
  • Backbone manufacturer
    Karl J. Clark
  • Backbone size w/o insert (bp) 2856
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    3x3 Stop sequence
  • Alt name
    Stop
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    3363

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aaaagcaagaaagaaaactagagtgg
  • 3′ sequencing primer atggctcataacaccccttg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Secondary gene is a gamma-crystalin promoter driving NLS-mRFP. Online tools and cloning help available at <www.genesculpt.org/gtaghd/>. May work in additional species beyond those listed. Please note that some discrepancies were found between Addgene's quality control result and the depositor's provided sequence. The depositor noted that these discrepancies do NOT affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPRISM-Stop-gcry-mRFP was a gift from Jeffrey Essner (Addgene plasmid # 117772 ; http://n2t.net/addgene:117772 ; RRID:Addgene_117772)
  • For your References section:

    Efficient targeted integration directed by short homology in zebrafish and mammalian cells. Wierson WA, Welker JM, Almeida MP, Mann CM, Webster DA, Torrie ME, Weiss TJ, Kambakam S, Vollbrecht MK, Lan M, McKeighan KC, Levey J, Ming Z, Wehmeier A, Mikelson CS, Haltom JA, Kwan KM, Chien CB, Balciunas D, Ekker SC, Clark KJ, Webber BR, Moriarity BS, Solin SL, Carlson DF, Dobbs DL, McGrail M, Essner J. Elife. 2020 May 15;9. pii: 53968. doi: 10.7554/eLife.53968. 10.7554/eLife.53968 PubMed 32412410