Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCarCBADE
(Plasmid #117757)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117757 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBbaA5k
  • Backbone manufacturer
    Genebank
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Codon optimised CarCBA, Protein CarD, Ferredoxin CarE
  • Alt name
    CarCBADE
  • Species
    Pectobacterium carotovorum
  • Insert Size (bp)
    3710
  • GenBank ID
  • Promoter PLac(UV5)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GCGTAGAGGATCGAGATCG
  • 3′ sequencing primer AACGCCCTAGGTATAAACGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCarCBADE was a gift from Greg Bokinsky (Addgene plasmid # 117757 ; http://n2t.net/addgene:117757 ; RRID:Addgene_117757)
  • For your References section:

    Metabolic engineering of a carbapenem antibiotic synthesis pathway in Escherichia coli. Shomar H, Gontier S, van den Broek NJF, Tejeda Mora H, Noga MJ, Hagedoorn PL, Bokinsky G. Nat Chem Biol. 2018 Aug;14(8):794-800. doi: 10.1038/s41589-018-0084-6. Epub 2018 Jun 25. 10.1038/s41589-018-0084-6 PubMed 29942079