pBS U6 WIP RNAi
(Plasmid
#11774)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 11774 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBS-U6-RNAi-dual-CMV-GFP
-
Backbone manufacturerYang Shi's lab (Harvard Medical School)
- Backbone size w/o insert (bp) 3500
-
Vector typeMammalian Expression, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameWIP RNAi
-
Alt nameWASp Interacting Protein
-
Alt nameWIP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)60
-
Entrez GeneWIPF1 (a.k.a. PRPL-2, WAS2, WASPIP, WIP)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer M13 forward 20 (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Yang Shi (Harvard Medical School) provided the pBS-U6 empty vector.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
RNAi directed against this sequence in WIP: GGAGGTTTCCTGTGCCTTCT
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBS U6 WIP RNAi was a gift from Jack Strominger (Addgene plasmid # 11774 ; http://n2t.net/addgene:11774 ; RRID:Addgene_11774) -
For your References section:
Formation of a WIP-, WASp-, actin-, and myosin IIA-containing multiprotein complex in activated NK cells and its alteration by KIR inhibitory signaling. Krzewski K, Chen X, Orange JS, Strominger JL. J Cell Biol. 2006 Apr 10. 173(1):121-32. 10.1083/jcb.200509076 PubMed 16606694