-
PurposeIntegration vector at an attB site in Bacteroides; contains 1kb cassette of aTC-regulatable promoter (RBS GH023) upstream of the NanoLuc gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117728 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepNBU2-ErmG
- Backbone size w/o insert (bp) 5907
- Total vector size (bp) 6362
-
Vector typeBacterial Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)EC100D pir-116
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNanoLuc
-
Insert Size (bp)516
-
GenBank IDAFI79290.1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCGCTTTCCAAGAGAAGAAAG
- 3′ sequencing primer CACAATATGAGCAACAAGGAATCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNBU2_erm-TetR-P1T_DP-GH023 - NanoLuc was a gift from Andrew Goodman (Addgene plasmid # 117728 ; http://n2t.net/addgene:117728 ; RRID:Addgene_117728) -
For your References section:
Engineered Regulatory Systems Modulate Gene Expression of Human Commensals in the Gut. Lim B, Zimmermann M, Barry NA, Goodman AL. Cell. 2017 Apr 20;169(3):547-558.e15. doi: 10.1016/j.cell.2017.03.045. 10.1016/j.cell.2017.03.045 PubMed 28431252