pEJS1084_pTetR-P2A-BFP/BspMI flexible sgRNA
(Plasmid #117687)

• Purpose: U6 driven Spy sgRNA cloning vector where guide sequences are inserted between BspMI sites. This plasmid works with Addgene #108570 for subnuclear proteomic profiling via C-BERST method.
• Depositing Lab: Erik Sontheimer
• Publication: Gao et al Methods Enzymol. 2019;616:365-383. doi: 10.1016/bs.mie.2018.10.030. Epub 2018 Dec 10.

Backbone

• Vector backbone: pLKO.1
• Backbone size w/o insert (bp): 7183
• Total vector size (bp): 9614
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Use FACS to sort out BFP positive cells.

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Kanamycin cassette
• Species: Bacterial origin
• Insert Size (bp): 1054
• Promoter: U6

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BspMI (destroyed during cloning)
• 3′ cloning site: BspMI (destroyed during cloning)
• 5′ sequencing primer: gcatatacgatacaaggctgt

Gene/Insert 2

• Gene/Insert name: TetR-P2A-BFP
• Species: Synthetic
• Insert Size (bp): 1437
• Promoter: hPGK

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cattctgcaagcctccgg

Resource Information

• Supplemental Documents:
  • pEJS1084_pTetR-P2A-BFP:BspMI flexible sgRNA.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry