eSpCas9(1.1)-Puro
(Plasmid #117686)

• Purpose: The plasmids pSpCas9 (BB)-2A-Puro (Addgene, #48139) and eSpCas9 (1.1) (Addgene, #71814) were combined to express both “enhanced specificity” Cas9 and puromycin resistance protein.
• Depositing Lab: Luc Leyns
• Publication: Liu et al Biochem Biophys Res Commun. 2019 Feb 14. pii: S0006-291X(19)30235-9. doi: 10.1016/j.bbrc.2019.02.048.

Backbone

• Vector backbone: pSpCas9(BB)-2A-Puro
• Backbone manufacturer: Feng Zhang Lab
• Backbone size w/o insert (bp): 9175
• Total vector size (bp): 9175
• Modifications to backbone: K (AAG) 848 A (GCC), K (AAG) 1003 A (GCG), R (CGG) 1060 A (GCG)
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: eSpCas9(1.1)
• Alt name: K848A, K1003A, R1060A
• Species: Synthetic
• Mutation: K848A, K1003A, R1060A
• Promoter: U6
• Tag / Fusion Protein:
  • PuroR (R166H)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: ApaI (not destroyed)
• 3′ cloning site: BsmI (not destroyed)
• 5′ sequencing primer: ACCCATTCCTGAAGGACAAC
• 3′ sequencing primer: TGGCCAGGTACAGGAAGTTC

Resource Information

• Supplemental Documents:
  • The eCas9(1.1)-Puro plasmid construction
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Created by Yang LIU and Luc LEYNS () from the Vrije Universiteit Brussel (Belgium).