Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHIPH4
(Plasmid #117685)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117685 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHIPH4
  • Backbone manufacturer
    Arjen Krikken
  • Backbone size w/o insert (bp) 5013
  • Total vector size (bp) 6519
  • Vector type
    Yeast Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Alcohol Oxidase promoter
  • Alt name
    Paox
  • Species
    Hansenula polymorpha
  • Insert Size (bp)
    1506
  • Promoter Alcohol Oxidase

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TGTGCTGCAAGGCGATTAAG
  • 3′ sequencing primer GGTGGTCATGGCGTAGGAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Title: Single-step Gene Knock Out of the SUC2 Gene in Saccharomyces cerevisiae: A Laboratory Exercise for Undergraduate Students†
Jurre Hageman1* and Arjen M. Krikken2
DOI: https://doi.org/10.1128/jmbe.v19i3.1615

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHIPH4 was a gift from Ida van der Klei (Addgene plasmid # 117685 ; http://n2t.net/addgene:117685 ; RRID:Addgene_117685)