LBJJ382
(Plasmid #117518)

• Purpose: Also known as LBJJ429. PCR template for sgRNA-EF with polyT, 67bp or 192bp terminator
• Depositing Lab: Jonathan D Jones
• Publication: Castel et al PLoS One. 2019 Jan 9;14(1):e0204778. doi: 10.1371/journal.pone.0204778. eCollection 2019.

Backbone

• Vector backbone: pICH47751
• Backbone size w/o insert (bp): 4352
• Total vector size (bp): 4880
• Vector type: Plant Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: BpiI:ACTA:pU6-26:sgRNA-EF:t192bp:TTAC:BpiI
• Species: Synthetic
• Insert Size (bp): 528
• Promoter: AtU6-26

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BpiI (not destroyed)
• 3′ cloning site: BpiI (not destroyed)
• 5′ sequencing primer: GTGGTGTAAACAAATTGACGC
• 3′ sequencing primer: GGATAAACCTTTTCACGCCC

Resource Information

• Supplemental Documents:
  • LBJJ382_sgRNA-EF_U6t_192_1;3.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Cloned by Laurence Tomlinson.

Primers to amplify a sgRNA:
Fw: ga GGTCTCa ATTG [x] GTTTAAGAGCTATGCTGGAA, where [x] is the 20nt spacer/target sequence (NOT including the PAM).
Rv: tgtggtctcaAGCGAAAAAAAGCACCGACTC (for polyT terminator)
tgtggtctcaAGCGACCCCAGAAATTGAAC (for 67 bp U6-26 terminator, recommanded)
tgtggtctcaAGCGTATTGGTTTATCTCATCG (for 192 bp U6-26 terminator).

The PCR amplicon is ready to clone in a Golden Gate fashion with U6-26 promoter (pICSL90002) and any Golden Gate compatible acceptor vector Level 1, using BsaI. Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.