Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

BCJJ339
(Plasmid #117501)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117501 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pICH47742
  • Backbone size w/o insert (bp) 4352
  • Total vector size (bp) 11158
  • Vector type
    Plant Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    BpiI:GCAA:RPS5a:Cas9-3(intron):E9:ACTA:BpiI
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
    6806
  • Promoter AtRPS5a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BpiI (not destroyed)
  • 3′ cloning site BpiI (not destroyed)
  • 5′ sequencing primer GTGGTGTAAACAAATTGACGC
  • 3′ sequencing primer GGATAAACCTTTTCACGCCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Cloned by Baptiste Castel . Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BCJJ339 was a gift from Jonathan D Jones (Addgene plasmid # 117501 ; http://n2t.net/addgene:117501 ; RRID:Addgene_117501)
  • For your References section:

    Optimization of T-DNA architecture for Cas9-mediated mutagenesis in Arabidopsis. Castel B, Tomlinson L, Locci F, Yang Y, Jones JDG. PLoS One. 2019 Jan 9;14(1):e0204778. doi: 10.1371/journal.pone.0204778. eCollection 2019. 10.1371/journal.pone.0204778 PubMed 30625150