pICSL11015
(Plasmid #117499)

• Purpose: FAST-Red selectable marker Golden Gate Level 1 Position 1
• Depositing Lab: Jonathan D Jones
• Publication: Castel et al PLoS One. 2019 Jan 9;14(1):e0204778. doi: 10.1371/journal.pone.0204778. eCollection 2019.

Backbone

• Vector backbone: pICH47732
• Backbone size w/o insert (bp): 4352
• Total vector size (bp): 6693
• Vector type: Plant Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: BpiI:TGCC:pOLE1:OLE1-RFP:OLE1t:GCAA:BpiI
• Alt name: FAST-Red
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 2341
• GenBank ID: AT4G25140
• Promoter: AtOLE1
• Tag / Fusion Protein:
  • RFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BpiI (not destroyed)
• 3′ cloning site: BpiI (not destroyed)
• 5′ sequencing primer: GTGGTGTAAACAAATTGACGC
• 3′ sequencing primer: GGATAAACCTTTTCACGCCC

Resource Information

• Supplemental Documents:
  • pICSL11015_FAST-Red_1;1.gbk
• A portion of this plasmid was derived from a plasmid made by: Synbio@TSL
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Cloned by Mark Youles . Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.