-
PurposeLentiviral vector for constitutive expression of sfCherry3C(1-10)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117482 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSFFV
- Backbone size w/o insert (bp) 9000
- Total vector size (bp) 9625
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesfCherry3C(1-10)
-
SpeciesSynthetic
-
Insert Size (bp)621
-
Mutation5 substitutions (K45R, G52D, T106A, K182R, N194D) based on sfCherry2(1-10)
- Promoter SFFV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCGGGCCCGGGATCCCATGGAGGAGGACAACATGG
- 3′ sequencing primer TCTAGAGTCGCGGCCGCTCAGTCCTCGTTGTGGCTGGTGATGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/454041v1 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSFFV_sfCherry3C(1-10) was a gift from Bo Huang (Addgene plasmid # 117482 ; http://n2t.net/addgene:117482 ; RRID:Addgene_117482) -
For your References section:
Bright split red fluorescent proteins for the visualization of endogenous proteins and synapses. Feng S, Varshney A, Coto Villa D, Modavi C, Kohler J, Farah F, Zhou S, Ali N, Muller JD, Van Hoven MK, Huang B. Commun Biol. 2019 Sep 17;2:344. doi: 10.1038/s42003-019-0589-x. eCollection 2019. 10.1038/s42003-019-0589-x PubMed 31552297