Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMO9075
(Plasmid #117481)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117481 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCR8/GW/TOPO
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2817
  • Total vector size (bp) 4836
  • Modifications to backbone
    pCR8/GW/TOPO + pBG1 (PCR product) => pMO719 || pMO719 (EcoRV digested) + kanR (PCR product from pCR-XL-TOPO) => pMO9071 || pMO9071 (BsaBI digest, religate) => pMO9072 || pMO9072 (HpaI/XmnI digest, religate) => pMO9072-1a || pMO9072-1a (EcoRV/BspEI digest, blunted, religated) => pMO9073 || pMO9073 (EcoRI digest, religate) => pMO9075
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Stable in Desulfovibrio vulgaris Hildenborough (low copy number). Use spectinomycin at 100 ug/ml. Promoter for exogenous expression of genes is strong, but is lacking a ribosomal binding site. See primers listed in Korte et al. (2014) for complementation of rex (primers SLIC DVU0916-comp-F and SLIC DVU0916-comp-R) for suggested primers.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Aph(3')-IIa promoter
  • Alt name
    Paph
  • Alt name
    Pkan
  • Species
    Escherichia coli
  • Insert Size (bp)
    50
  • GenBank ID
    NC_008460.1
  • Promoter Aph(3')-IIa promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Blunt-end cloned (destroyed during cloning)
  • 3′ cloning site Blunt-end cloned (destroyed during cloning)
  • 5′ sequencing primer AGACACGGGCCAGAGCTG
  • 3′ sequencing primer GCTGAAAGCGAGAAGAGCGCAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMO9075 was a gift from Judy Wall (Addgene plasmid # 117481 ; http://n2t.net/addgene:117481 ; RRID:Addgene_117481)
  • For your References section:

    Methods for engineering sulfate reducing bacteria of the genus Desulfovibrio. Keller KL, Wall JD, Chhabra S. Methods Enzymol. 2011;497:503-17. doi: 10.1016/B978-0-12-385075-1.00022-6. 10.1016/B978-0-12-385075-1.00022-6 PubMed 21601101