pMRXIP 3xFLAG-VMP1
(Plasmid #117416)

• Purpose: Expresses VMP1 tagged with 3xFLAG in mammalian cells
• Depositing Lab: Noboru Mizushima
• Publication: Morita et al J Cell Biol. 2018 Aug 9. pii: jcb.201804132. doi: 10.1083/jcb.201804132.

Backbone

• Vector backbone: pMRXIP GFP-Ci2
• Backbone manufacturer: Dr.Shoji Yamaoka of Tokyo Medical and Dental University
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: VMP1
• Species: H. sapiens (human)
• Entrez Gene: VMP1 (a.k.a. EPG3, TANGO5, TMEM49)
• Tag / Fusion Protein:
  • 3xFLAG (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: GGCATCGCAGCTTGGATACACGCC

Resource Information

• Supplemental Documents:
  • pMRXIPU 3xFLAG-VMP1.gbk
• A portion of this plasmid was derived from a plasmid made by: It has the pMX backbone
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry