pMXs GFP-LC3-RFP
(Plasmid #117413)

• Purpose: Expresses GFP-LC3-RFP in mammalian cells to measure autophagic flux without any drug resistance.
• Depositing Lab: Noboru Mizushima
• Publication: Morita et al J Cell Biol. 2018 Aug 9. pii: jcb.201804132. doi: 10.1083/jcb.201804132.

Backbone

• Vector backbone: pMXs-IP
• Backbone manufacturer: Dr. Toshio Kitamura of the University of Tokyo
• Backbone size w/o insert (bp): 5847
• Vector type: Mammalian Expression, Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: microtubule-associated protein 1 light chain 3 beta
• Alt name: Map1lc3b
• Alt name: LC3
• Alt name: LC3B
• Species: R. norvegicus (rat)
• Insert Size (bp): 2200
• GenBank ID: NM_022867.2
• Entrez Gene: Map1lc3b (a.k.a. LC3B, Map1lc3, Mpl3, zbs559)
• Tags / Fusion Proteins:
  • EGFP (N terminal on insert)
  • mRFP1 (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CGACCACTACCAGCAGAACA

Resource Information

• Supplemental Documents:
  • pMXs GFP-LC3-RFP.gbk
• A portion of this plasmid was derived from a plasmid made by: It has the pMX backbone
• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry