pLKO.1-puro-U6-AsCas12a-TLR-MCV1-gRNA
(Plasmid #117411)

• Purpose: AsCas12a-gRNA targeting TLR2.0
• Depositing Lab: Erik Sontheimer
• Publication: Iyer et al CRISPR J. 2022 Oct;5(5):685-701. doi: 10.1089/crispr.2022.0058. Epub 2022 Sep 7.

Backbone

• Vector backbone: pLKO.1-puro-U6
• Backbone manufacturer: Addgene#50920
• Total vector size (bp): 7000
• Modifications to backbone: Added the gRNA sequence of FnCas12a targeting TLR2.0
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: AsCas12a gRNA targeting TLR 2.0
• Species: Synthetic
• Insert Size (bp): 100
• Promoter: U6

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGTGACGTAGAAAGTAATAATTTC
• 3′ sequencing primer: CCTCGAGCCGCGGCCAAAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Derived from Addgene # 50920
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid contains an IS1 prokaryotic transposable element that does not affect plasmid function.

Please visit https://www.biorxiv.org/content/10.1101/864199v1 for bioRxiv preprint.