pTn7xKS-mPlum
(Plasmid
#117396)
-
PurposeTn7 tagging vector pTn7xKS with mPlum expression scaffold
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117396 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC18
-
Modifications to backboneA gene encoding the Lac repressor (lacIQ allele) and a lac-controlled synthetic operon containing three genes encoding the antibacterial toxins HokB, GhoT, and TisB were inserted into the backbone via blunt-ligation into a blunted NdeI restriction site.
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsAlso carries a gentamicin selectable marker
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemPlum
-
SpeciesSynthetic
-
Insert Size (bp)1154
- Promoter Ptac
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (destroyed during cloning)
- 3′ cloning site SpeI (destroyed during cloning)
- 5′ sequencing primer caaagggaatcaggggatct
- 3′ sequencing primer gaggggtggaaatggagttt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTn7xKS-mPlum was a gift from Karen Guillemin (Addgene plasmid # 117396 ; http://n2t.net/addgene:117396 ; RRID:Addgene_117396) -
For your References section:
Modernized Tools for Streamlined Genetic Manipulation and Comparative Study of Wild and Diverse Proteobacterial Lineages. Wiles TJ, Wall ES, Schlomann BH, Hay EA, Parthasarathy R, Guillemin K. MBio. 2018 Oct 9;9(5). pii: mBio.01877-18. doi: 10.1128/mBio.01877-18. 10.1128/mBio.01877-18 PubMed 30301859