pTn7xKS-dTomato
(Plasmid #117395)

• Purpose: Tn7 tagging vector pTn7xKS with dTomato expression scaffold
• Depositing Lab: Karen Guillemin
• Publication: Wiles et al MBio. 2018 Oct 9;9(5). pii: mBio.01877-18. doi: 10.1128/mBio.01877-18.

Backbone

• Vector backbone: pUC18
• Modifications to backbone: A gene encoding the Lac repressor (lacIQ allele) and a lac-controlled synthetic operon containing three genes encoding the antibacterial toxins HokB, GhoT, and TisB were inserted into the backbone via blunt-ligation into a blunted NdeI restriction site.
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Also carries a gentamicin selectable marker
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dTomato
• Species: Synthetic
• Insert Size (bp): 985
• Promoter: Ptac

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (destroyed during cloning)
• 3′ cloning site: SpeI (destroyed during cloning)
• 5′ sequencing primer: caaagggaatcaggggatct
• 3′ sequencing primer: gaggggtggaaatggagttt

Resource Information

• Supplemental Documents:
  • pTn7xKS-dTomato.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry