pTn7xTS-sfGFP
(Plasmid #117390)

• Purpose: Tn7 tagging vector pTn7xTS with sfGFP expression scaffold
• Depositing Lab: Karen Guillemin
• Publication: Wiles et al MBio. 2018 Oct 9;9(5). pii: mBio.01877-18. doi: 10.1128/mBio.01877-18.

Backbone

• Vector backbone: pUC18R6K
• Modifications to backbone: The temperature-sensitive origin of replication ori101/repA101ts was inserted via blunt-ligation into the R6K origin of replication, rendering the R6K ori dysfunctional.
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Growth instructions: Also carries a gentamicin selectable marker
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: sfGFP
• Species: Synthetic
• Insert Size (bp): 996
• Promoter: Ptac

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SmaI (destroyed during cloning)
• 3′ cloning site: SmaI (destroyed during cloning)
• 5′ sequencing primer: caaagggaatcaggggatct
• 3′ sequencing primer: gaggggtggaaatggagttt

Resource Information

• Supplemental Documents:
  • pTn7xTS-sfGFP.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry