pXS-dTomato
(Plasmid
#117387)
-
PurposepGEN-mcs with a modular dTomato expression scaffold
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117387 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGEN-mcs (ori15A)
-
Modifications to backboneExpression scaffold contains modular promoter, 5' UTR, and 3' UTR sequences
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namedTomato
-
SpeciesSynthetic
-
Insert Size (bp)705
- Promoter Ptac
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ggctggataaagggaactca
- 3′ sequencing primer gcgggctagctcattatttg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXS-dTomato was a gift from Karen Guillemin (Addgene plasmid # 117387 ; http://n2t.net/addgene:117387 ; RRID:Addgene_117387) -
For your References section:
Modernized Tools for Streamlined Genetic Manipulation and Comparative Study of Wild and Diverse Proteobacterial Lineages. Wiles TJ, Wall ES, Schlomann BH, Hay EA, Parthasarathy R, Guillemin K. MBio. 2018 Oct 9;9(5). pii: mBio.01877-18. doi: 10.1128/mBio.01877-18. 10.1128/mBio.01877-18 PubMed 30301859