Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Pmyo-3::hpo-30 gDNA (pBAB204)
(Plasmid #117385)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117385 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pPD49.26
  • Backbone size w/o insert (bp) 3410
  • Modifications to backbone
    Pmyo-3 (2500bp of the myo-3 promoter) is present upstream of the hpo-30 genomic DNA
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    genomic DNA of hpo-30 (833 bp)
  • gRNA/shRNA sequence
    ATGCCATTAATTATGTACAAATTTCTATTAGTCACTTCAATATTCTTAATCGTTTCCGGGCTAATATTAACTGCGTTCTC, GTTGTTTAGTCCTCTTTGGGAAgtaagtttctagtcaataaaattctggttttttttaaatgtcaattttgtagGTAGTT, GATTTTCCTCGTTCTCATTTATCACATCATCACGGTCTTTGGTGGGATTGTATTGTACATCATGAAACTTTAATTCCGTT, ACATGAAGATCAAGCAGAACTTCGAGgtaccttttttctgcttttgttttctaaataaaacaagtttaagGTGATCGATG, TGATAGTAAGATGGATTCTTCGGTTCAAGCATCATTAAGAGTTGCTCTTGAAAAAGGAGATGAAGAGGCCAGAGAGCTTT, TGTTACATCGGTTTCTACgtaagttaacaatattttaatgcttttcatgtgccgaaacttacttttttctttgttagaaa, gataaactagaaactatataaaactgatttaccaaatgcaggttcaagttattttttaaaataattagagtgtgagcgta, gtagttcaataatttgttgatcaattttctctttctggatacagaagcgtattggcattgcaacgtacatacacatgttt, ggttccatgctattaattcaattgattttctgtcttaaattctaggactgtaatgctattttttgtaatttagtattttc, tgatctagaatatgcggtaacaataaattagattttactgtccaaacacaaaattactgaagatacaagttgattttata, ttcttcatgaaaccaaaaaaaaattaatttcagCTCATCACAAAGGTGTAATTTTCTTCGCAGTTTTCACTTTTGTTTTC, gttgtttagtcctctttgggaagtaagtttctagtcaataaaattctggttttttttaaatgtcaattttgtaggtagtt, gattttcctcgttctcatttatcacatcatcacggtctttggtgggattgtattgtacatcatgaaactttaattccgtt, acatgaagatcaagcagaacttcgaggtaccttttttctgcttttgttttctaaataaaacaagtttaaggtgatcgatg, tgatagtaagatggattcttcggttcaagcatcattaagagttgctcttgaaaaaggagatgaagaggccagagagcttt, tgttacatcggtttctacgtaagttaacaatattttaatgcttttcatgtgccgaaacttacttttttctttgttagaaa, gataaactagaaactatataaaactgatttaccaaatgcaggttcaagttattttttaaaataattagagtgtgagcgta, gtagttcaataatttgttgatcaattttctctttctggatacagaagcgtattggcattgcaacgtacatacacatgttt, ggttccatgctattaattcaattgattttctgtcttaaattctaggactgtaatgctattttttgtaatttagtattttc, tgatctagaatatgcggtaacaataaattagattttactgtccaaacacaaaattactgaagatacaagttgattttata, ttcttcatgaaaccaaaaaaaaattaatttcagctcatcacaaaggtgtaattttcttcgcagttttcacttttgttttc
  • Species
    C. elegans (nematode)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer unknown
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Pmyo-3::hpo-30 gDNA (pBAB204) was a gift from Kavita Babu (Addgene plasmid # 117385 ; http://n2t.net/addgene:117385 ; RRID:Addgene_117385)
  • For your References section:

    The Claudin-like Protein HPO-30 Is Required to Maintain LAChRs at the C. elegans Neuromuscular Junction. Sharma P, Li L, Liu H, Tikiyani V, Hu Z, Babu K. J Neurosci. 2018 Aug 8;38(32):7072-7087. doi: 10.1523/JNEUROSCI.3487-17.2018. Epub 2018 Jun 27. 10.1523/JNEUROSCI.3487-17.2018 PubMed 29950505