CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
(Plasmid #117384)

• Purpose: An AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectively
• Depositing Lab: Viviana Gradinaru
• Publication: Challis et al Nat Protoc. 2019 Feb;14(2):379-414. doi: 10.1038/s41596-018-0097-3.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 5352
• Total vector size (bp): 6000
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
• Species: Synthetic
• Insert Size (bp): 1353
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: atgggttctcatcatc (unknown if destroyed)
• 3′ cloning site: tgatgacagcgaagtga (unknown if destroyed)
• 5′ sequencing primer: pCAG-F
• 3′ sequencing primer: WPRE-R

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry