CAG-eYFP-3x-miR708-5p-TS
(Plasmid
#117381)
-
PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neurons
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117381 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5274
- Total vector size (bp) 6000
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ATGgtgagcaagggcg (unknown if destroyed)
- 3′ cloning site gacgagctgtacaagTAA (unknown if destroyed)
- 5′ sequencing primer pCAG-F (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAG-eYFP-3x-miR708-5p-TS was a gift from Viviana Gradinaru (Addgene plasmid # 117381 ; http://n2t.net/addgene:117381 ; RRID:Addgene_117381) -
For your References section:
Systemic AAV vectors for widespread and targeted gene delivery in rodents. Challis RC, Ravindra Kumar S, Chan KY, Challis C, Beadle K, Jang MJ, Kim HM, Rajendran PS, Tompkins JD, Shivkumar K, Deverman BE, Gradinaru V. Nat Protoc. 2019 Feb;14(2):379-414. doi: 10.1038/s41596-018-0097-3. 10.1038/s41596-018-0097-3 PubMed 30626963