Skip to main content
Addgene

CAG-eYFP-3x-miR204-5p-TS
(Plasmid #117380)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117380 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 5274
  • Total vector size (bp) 6000
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
  • Species
    Synthetic
  • Insert Size (bp)
    720
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ATGgtgagcaagggcg (unknown if destroyed)
  • 3′ cloning site gagctgtacaagTAA (unknown if destroyed)
  • 5′ sequencing primer pCAG-F
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CAG-eYFP-3x-miR204-5p-TS was a gift from Viviana Gradinaru (Addgene plasmid # 117380 ; http://n2t.net/addgene:117380 ; RRID:Addgene_117380)

  • For your References section:

    Systemic AAV vectors for widespread and targeted gene delivery in rodents. Challis RC, Ravindra Kumar S, Chan KY, Challis C, Beadle K, Jang MJ, Kim HM, Rajendran PS, Tompkins JD, Shivkumar K, Deverman BE, Gradinaru V. Nat Protoc. 2019 Feb;14(2):379-414. doi: 10.1038/s41596-018-0097-3. 10.1038/s41596-018-0097-3 PubMed 30626963
Related items:
Commonly requested with: