Skip to main content
Addgene

pmiRGLO-LEMD2-201
(Plasmid #117349)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117349 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pmiRGLO
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 7334
  • Vector type
    Mammalian Expression, Luciferase
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    3' UTR LEMD2-201
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1426
  • Promoter Murine PGK-1
  • Tag / Fusion Protein
    • luciferase (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer Fluc-F1 (AGAAGCTGCGCGGTGGTGTTGTG)
  • 3′ sequencing primer T7terminal
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5' NheI cloning site destroyed, 3' XbaI cloning site destroyed

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmiRGLO-LEMD2-201 was a gift from Volker Busskamp (Addgene plasmid # 117349 ; http://n2t.net/addgene:117349 ; RRID:Addgene_117349)
  • For your References section:

    Combined Experimental and System-Level Analyses Reveal the Complex Regulatory Network of miR-124 during Human Neurogenesis. Kutsche LK, Gysi DM, Fallmann J, Lenk K, Petri R, Swiersy A, Klapper SD, Pircs K, Khattak S, Stadler PF, Jakobsson J, Nowick K, Busskamp V. Cell Syst. 2018 Sep 28. pii: S2405-4712(18)30358-2. doi: 10.1016/j.cels.2018.08.011. 10.1016/j.cels.2018.08.011 PubMed 30292704