pSpCas9(BB)-2A-Puro (PX459)+gRNA miR-124-2/3-3'
(Plasmid
#117325)
-
PurposeCRISPR-Cas9 for miR-124-2/3, 3'
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117325 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePX459
-
Backbone manufacturerZhang Lab
- Backbone size w/o insert (bp) 9157
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA miR-124-2/3-3'
-
Alt nameNR_029670
-
Alt nameENSG00000207598
-
gRNA/shRNA sequencegcacgcggtgaatgccaagag
-
SpeciesSynthetic
-
Insert Size (bp)21
-
Entrez GeneMIR124-3 (a.k.a. MIRN124-3, MIRN124A3, mir-124-3)
- Promoter U6
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer TTTCTTGGGTAGTTTGCAGTTTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cas9 with NLS included; cuts two loci (2 and 3) of miR-124
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpCas9(BB)-2A-Puro (PX459)+gRNA miR-124-2/3-3' was a gift from Volker Busskamp (Addgene plasmid # 117325 ; http://n2t.net/addgene:117325 ; RRID:Addgene_117325) -
For your References section:
Combined Experimental and System-Level Analyses Reveal the Complex Regulatory Network of miR-124 during Human Neurogenesis. Kutsche LK, Gysi DM, Fallmann J, Lenk K, Petri R, Swiersy A, Klapper SD, Pircs K, Khattak S, Stadler PF, Jakobsson J, Nowick K, Busskamp V. Cell Syst. 2018 Sep 28. pii: S2405-4712(18)30358-2. doi: 10.1016/j.cels.2018.08.011. 10.1016/j.cels.2018.08.011 PubMed 30292704