pcDNA3.1+DPP6
(Plasmid
#117272)
-
PurposeEncodes human DPP6 variant 1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117272 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1+
-
Backbone manufacturerGenescript
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 7982
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDPP6
-
Alt nameDPP6
-
SpeciesH. sapiens (human)
-
GenBank IDNM_130797.3
-
Entrez GeneDPP6 (a.k.a. DPL1, DPPX, MRD33, VF2)
- Promoter CMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1+DPP6 was a gift from Mark Cannell (Addgene plasmid # 117272 ; http://n2t.net/addgene:117272 ; RRID:Addgene_117272) -
For your References section:
Regulation of Kv4.3 and hERG potassium channels by KChIP2 isoforms and DPP6 and response to the dual K(+) channel activator NS3623. Lainez S, Doray A, Hancox JC, Cannell MB. Biochem Pharmacol. 2018 Apr;150:120-130. doi: 10.1016/j.bcp.2018.01.036. Epub 2018 Jan 31. 10.1016/j.bcp.2018.01.036 PubMed 29378180