MSCV-Ccdc134-IRES-BFP
(Plasmid
#117266)
-
PurposeRetroviral overexpression of Ccdc134
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117266 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMSCV
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCcdc134
-
Entrez GeneCcdc134 (a.k.a. 2310042L06Rik, AW208859)
- Promoter LTR
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTTGAACCTCCTCGTTCGAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV-Ccdc134-IRES-BFP was a gift from Sarah Teichmann (Addgene plasmid # 117266 ; http://n2t.net/addgene:117266 ; RRID:Addgene_117266) -
For your References section:
Genome-wide CRISPR Screens in T Helper Cells Reveal Pervasive Crosstalk between Activation and Differentiation. Henriksson J, Chen X, Gomes T, Ullah U, Meyer KB, Miragaia R, Duddy G, Pramanik J, Yusa K, Lahesmaa R, Teichmann SA. Cell. 2019 Jan 7. pii: S0092-8674(18)31569-1. doi: 10.1016/j.cell.2018.11.044. 10.1016/j.cell.2018.11.044 PubMed 30639098