pAGM22082_cRed
(Plasmid
#117225)
-
PurposepET-28b backbone plasmid, Level 2 Golden Gate expression plasmid.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117225 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28-b
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5325
- Total vector size (bp) 13411
-
Modifications to backboneIntroduced mutations for Type IIs cleavage site removal
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCanthaxanthin Operon
-
SpeciesErwinia uredovora, Escherichia Coli, Agrobacterium aurantiacum
-
Insert Size (bp)8086
-
Mutationremoved Type IIS restriction sites within the backbone (BsaI and BbsI)
-
GenBank IDD90087.2
- Promoter T7 RNA Polymerase
-
Tag
/ Fusion Protein
- 34 amino acid N-terminal linker, Hexahistidine Tag, T7 Leader Tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstXI (not destroyed)
- 3′ cloning site BstXI (not destroyed)
- 5′ sequencing primer GAAGGAGATATACCATGGGCAGCAG
- 3′ sequencing primer CGTTTAGAGGCCCCAAGGGGTTATG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycanthaxanthin operon as previously described in pAGM4673 (Plasmid #48014)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAGM22082_cRed was a gift from Sylvestre Marillonnet (Addgene plasmid # 117225 ; http://n2t.net/addgene:117225 ; RRID:Addgene_117225) -
For your References section:
Golden Mutagenesis: An efficient multi-site-saturation mutagenesis approach by Golden Gate cloning with automated primer design. Pullmann P, Ulpinnis C, Marillonnet S, Gruetzner R, Neumann S, Weissenborn MJ. Sci Rep. 2019 Jul 29;9(1):10932. doi: 10.1038/s41598-019-47376-1. 10.1038/s41598-019-47376-1 PubMed 31358887