pAAV-DIO-SYP-HRP
(Plasmid #117186)

• Purpose: Plasmid name in publication: pAAV-DIO-SV-HRP. Peroxidase reporter for multiplexed electron microscopy labeling
• Depositing Lab: David Ginty
• Publication: Zhang et al Nat Neurosci. 2019 Mar 18. pii: 10.1038/s41593-019-0358-7. doi: 10.1038/s41593-019-0358-7.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 5611
• Total vector size (bp): 7492
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SYP-HRP
• Alt name: pAAV-DIO-SV-HRP
• Species: A. rusticana (horseradish)
• Insert Size (bp): 1881
• Promoter: EF1a

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tcaagcctcagacagtggttc
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • pAAV-DIO-SYP-HRP.gb
  • Staining Protocol
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry