Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-FDIO-COX4-dAPEX2
(Plasmid #117178)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117178 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 5651
  • Total vector size (bp) 6524
  • Vector type
    Mammalian Expression, AAV ; Flp/FRT

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    COX4-dAPEX2
  • Alt name
    pAAV-FDIO-Matrix-dAPEX2
  • Species
    G. max (soybean)
  • Insert Size (bp)
    873
  • Mutation
    W41F and A134P on soybean APX
  • Promoter EF1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tcaagcctcagacagtggttc
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-FDIO-COX4-dAPEX2 was a gift from David Ginty (Addgene plasmid # 117178 ; http://n2t.net/addgene:117178 ; RRID:Addgene_117178)
  • For your References section:

    Multiplexed peroxidase-based electron microscopy labeling enables simultaneous visualization of multiple cell types. Zhang Q, Lee WA, Paul DL, Ginty DD. Nat Neurosci. 2019 Mar 18. pii: 10.1038/s41593-019-0358-7. doi: 10.1038/s41593-019-0358-7. 10.1038/s41593-019-0358-7 PubMed 30886406