pBC2102-reci
(Plasmid
#117171)
-
PurposeU6-sgRNA-EFS-Cas9-T2A-mCherry-P2A-Hygro; wtCas9 without NLS
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117171 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneLenti
- Backbone size w/o insert (bp) 8855
- Total vector size (bp) 12956
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namereci_wtCas9 without NLS
- Promoter U6 Promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (not destroyed)
- 3′ cloning site BsmBI (not destroyed)
- 5′ sequencing primer gtgacgtagaaagtaataatttcttggg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBC2102-reci was a gift from David Savage (Addgene plasmid # 117171 ; http://n2t.net/addgene:117171 ; RRID:Addgene_117171) -
For your References section:
Profiling of engineering hotspots identifies an allosteric CRISPR-Cas9 switch. Oakes BL, Nadler DC, Flamholz A, Fellmann C, Staahl BT, Doudna JA, Savage DF. Nat Biotechnol. 2016 May 2. doi: 10.1038/nbt.3528. 10.1038/nbt.3528 PubMed 27136077