Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKLV2-U6(gCD44v2)-EF1a-BFP-Puro-Cas9(FZ)
(Plasmid #117134)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117134 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pKLV2-U6(BsmBI)-EF1a-BFP-Puro-Cas9(FZ)
  • Backbone size w/o insert (bp) 14044
  • Vector type
    Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gCD44 v2
  • gRNA/shRNA sequence
    gggaggtgttggacgtgacg
  • Species
    Synthetic
  • Insert Size (bp)
    20
  • Mutation
    Deleted BbsI site within WPRE, modified BFP
  • Entrez Gene
    Cd44 (a.k.a. HERMES, Ly-24, Pgp-1)
  • Promoter human U6 promoter, human EF1a promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKLV2-U6(gCD44v2)-EF1a-BFP-Puro-Cas9(FZ) was a gift from Kosuke Yusa (Addgene plasmid # 117134 ; http://n2t.net/addgene:117134 ; RRID:Addgene_117134)