pKLV2-U6(gCD44v2)-EF1a-BFP-Puro-Cas9(FZ)
(Plasmid #117134)

• Purpose: All-in-one expression vector for Cas9 and gRNA against CD44
• Depositing Lab: Kosuke Yusa
• Publication: Yusa CRISPR-Cas9 and mammalian expression plasmids (unpublished)

Backbone

• Vector backbone: pKLV2-U6(BsmBI)-EF1a-BFP-Puro-Cas9(FZ)
• Backbone size w/o insert (bp): 14044
• Vector type: Lentiviral, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: gCD44 v2
• gRNA/shRNA sequence: gggaggtgttggacgtgacg
• Species: Synthetic
• Insert Size (bp): 20
• Mutation: Deleted BbsI site within WPRE, modified BFP
• Entrez Gene: Cd44 (a.k.a. HERMES, Ly-24, Pgp-1)
• Promoter: human U6 promoter, human EF1a promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)

Resource Information

• Supplemental Documents:
  • pKLV2-U6(gCD44 v2)-EF1aBFPpuroCas9fz.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry