Skip to main content
Addgene

pJet1.2 HA6-Tag
(Plasmid #117126)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117126 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pJet1.2
  • Backbone manufacturer
    Thermo scientific
  • Backbone size w/o insert (bp) 2974
  • Total vector size (bp) 3214
  • Vector type
    Golden gate donor vector for gene targeting in Bacillus subtilis

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    6xHA Tag
  • Alt name
    hexa Hemaglutinine Tag ; 6xHemaglutinine Tag
  • Insert Size (bp)
    220
  • GenBank ID
  • Tag / Fusion Protein
    • 6xHA tag (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGACTCACTATAGGGAGAGCGGC
  • 3′ sequencing primer AAGAACATCGATTTTCCATGGCAG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Donor vector for Golden gate assembly reactions that encodes for a C-terminal 6xHA tag. Overhangs generated upon BsaI cleavage : AGCG (RtagN) and TAAG (RtagC).

(Gruber lab reference pSG1106)

Addgene NGS results identified an IS1 element located between the CAP binding site and the lac UV5 promoter. This element will not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJet1.2 HA6-Tag was a gift from Stephan Gruber (Addgene plasmid # 117126 ; http://n2t.net/addgene:117126 ; RRID:Addgene_117126)

  • For your References section:

    High-Throughput Allelic Replacement Screening in Bacillus subtilis. Diebold-Durand ML, Burmann F, Gruber S. Methods Mol Biol. 2019;2004:49-61. doi: 10.1007/978-1-4939-9520-2_5. 10.1007/978-1-4939-9520-2_5 PubMed 31147909
Related items: