pJet1.2 Tev-Halo tag
(Plasmid #117124)

• Purpose: C-terminal Tev Halo-Tag
• Depositing Lab: Stephan Gruber
• Publication: Diebold-Durand et al Methods Mol Biol. 2019;2004:49-61. doi: 10.1007/978-1-4939-9520-2_5.

Backbone

• Vector backbone: pJet1.2
• Backbone manufacturer: Thermo scientific
• Backbone size w/o insert (bp): 2974
• Total vector size (bp): 3922
• Vector type: Golden gate donor vector for gene targeting in Bacillus subtilis

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Tev-Halo-tag Tag
• Alt name: Tev-Halo-tag
• Insert Size (bp): 930
• GenBank ID:
• Tag / Fusion Protein:
  • Tev-Halo-Tag (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CGACTCACTATAGGGAGAGCGGC
• 3′ sequencing primer: AAGAACATCGATTTTCCATGGCAG

Resource Information

• Supplemental Documents:
  • pJet1.2 TEV-HaloTag.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Donor vector for Golden gate assembly reactions that encodes for a C-terminal Halo-tag Tag followed by Tev cleavage site. Overhangs generated upon BsaI cleavage : AGCG (RtagN) and TAAG (RtagC).

(Gruber lab reference pSG711)