pCVL-UCOE-SFFV-TLR-MCV1
(Plasmid #117111)

• Purpose: Lentiviral vector encoding Traffic light reporter 2.0. Alternative name: pCVL-UCOE-SFFV-TLR-MCV1.
• Depositing Lab: Erik Sontheimer
• Publication: Iyer et al CRISPR J. 2022 Oct;5(5):685-701. doi: 10.1089/crispr.2022.0058. Epub 2022 Sep 7.

Backbone

• Vector backbone: pCVL
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 8600
• Modifications to backbone: Insertion of minimal UCOE, SFFV promoter and Traffic Light Reporter sequence.
• Vector type: Mammalian Expression, Lentiviral ; Reporter
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: UCOE SFFV Traffic Light Reporter 2.0
• Species: Synthetic
• Insert Size (bp): 2600
• Promoter: SFFV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AGTGCAGGGGAAAGAATAGTAGAC
• 3′ sequencing primer: WPRE-R

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The plasmid was derived from two other Addgene plasmids (Addgene#31482 and 85969)
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/864199v1 for bioRxiv preprint.