pJL1-mRFP1 gRNA
(Plasmid #117052)

• Purpose: In vitro expression of anti-mRFP1 Cas9 sgRNA from the T7 promoter
• Depositing Lab: Michael Jewett
• Publication: Stark et al ACS Synth Biol. 2019 May 7. doi: 10.1021/acssynbio.8b00381.

Backbone

• Vector backbone: pJL1 (modified)
• Backbone size w/o insert (bp): 1631
• Total vector size (bp): 1777
• Modifications to backbone: deleted ribosome binding site, spacer nucleotides between T7 promoter, insert, and terminator
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: anti-mRFP1 SpCas9 gRNA
• Species: Synthetic
• Insert Size (bp): 146
• Promoter: T7

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cgcctggtatctttatagtc

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry