pJL1-SpCas9
(Plasmid #117051)

• Purpose: In vitro expression of S. pyogenes Cas9 from the T7 promoter
• Depositing Lab: Michael Jewett
• Publication: Stark et al ACS Synth Biol. 2019 May 7. doi: 10.1021/acssynbio.8b00381.

Backbone

• Vector backbone: pJL1
• Backbone size w/o insert (bp): 1759
• Total vector size (bp): 5869
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: S. pyogenes Cas9
• Species: S. pyogenes
• Insert Size (bp): 4107
• Promoter: T7

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TAGTTATTGCTCAGCGGTGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Addgene 62225

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry