Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJL1-SpCas9
(Plasmid #117051)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117051 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJL1
  • Backbone size w/o insert (bp) 1759
  • Total vector size (bp) 5869
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    S. pyogenes Cas9
  • Species
    S. pyogenes
  • Insert Size (bp)
    4107
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGTTATTGCTCAGCGGTGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene 62225

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJL1-SpCas9 was a gift from Michael Jewett (Addgene plasmid # 117051 ; http://n2t.net/addgene:117051 ; RRID:Addgene_117051)
  • For your References section:

    BioBits Health: Classroom Activities Exploring Engineering, Biology, and Human Health with Fluorescent Readouts. Stark JC, Huang A, Hsu KJ, Dubner RS, Forbrook J, Marshalla S, Rodriguez F, Washington M, Rybnicky GA, Nguyen PQ, Hasselbacher B, Jabri R, Kamran R, Koralewski V, Wightkin W, Martinez T, Jewett MC. ACS Synth Biol. 2019 May 7. doi: 10.1021/acssynbio.8b00381. 10.1021/acssynbio.8b00381 PubMed 30925042