pJL1-neoR
(Plasmid
#117048)
-
PurposeIn vitro expression of neoR (kanamycin resistance gene) from the T7 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117048 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJL1
- Backbone size w/o insert (bp) 1759
- Total vector size (bp) 2578
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameneoR
-
Alt namekanamycin resistance gene
-
Insert Size (bp)816
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGTTATTGCTCAGCGGTGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene 69496
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJL1-neoR was a gift from Michael Jewett (Addgene plasmid # 117048 ; http://n2t.net/addgene:117048 ; RRID:Addgene_117048) -
For your References section:
BioBits Health: Classroom Activities Exploring Engineering, Biology, and Human Health with Fluorescent Readouts. Stark JC, Huang A, Hsu KJ, Dubner RS, Forbrook J, Marshalla S, Rodriguez F, Washington M, Rybnicky GA, Nguyen PQ, Hasselbacher B, Jabri R, Kamran R, Koralewski V, Wightkin W, Martinez T, Jewett MC. ACS Synth Biol. 2019 May 7. doi: 10.1021/acssynbio.8b00381. 10.1021/acssynbio.8b00381 PubMed 30925042