pCDF-MCM4/6
(Plasmid #116951)

• Purpose: Expresses human MCM4 and human MCM6
• Depositing Lab: James Chong
• Publication: Hesketh et al J Biol Chem. 2015 Mar 20;290(12):7973-9. doi: 10.1074/jbc.M114.622738. Epub 2015 Feb 3.

Backbone

• Vector backbone: pCDFDuet-1
• Total vector size (bp): 8757
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Human MCM6
• Alt name: minichromosome maintenance 6
• Alt name: DNA replication licensing factor
• Species: H. sapiens (human)
• Insert Size (bp): 2507
• GenBank ID: NP_005906.2
• Entrez Gene: MCM6 (a.k.a. MCG40308, Mis5, P105MCM)
• Tag / Fusion Protein:
  • His6 (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: gacgacgacaagatggacctcgcggcggcagcgg
• 3′ sequencing primer: cgcgggcggccgtcaatcttcgagcaagtagttaggg

Gene/Insert 2

• Gene/Insert name: Human MCM4
• Alt name: minichromosome maintenance 4
• Alt name: DNA replication licensing factor
• Species: H. sapiens (human)
• Insert Size (bp): 2612
• Entrez Gene: MCM4 (a.k.a. CDC21, CDC54, IMD54, NKCD, NKGCD, P1-CDC21, hCdc21)

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: gcgggcccggccttcatgtcgtccccggcgtcgacccc
• 3′ sequencing primer: gaggagaagcccggtcagagcaagcgcacggtcttccc

Resource Information

• Supplemental Documents:
  • pCDF-MCM4_6.gb
• A portion of this plasmid was derived from a plasmid made by: Juan Mendez, CSIC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that mutation L657M in human MCM4 was found during Addgene's quality control. The depositor noted that this mutation does NOT affect plasmid function.