pRSF-MCM3/5
(Plasmid #116950)

• Purpose: Expresses human MCM3 and human MCM5
• Depositing Lab: James Chong
• Publication: Hesketh et al J Biol Chem. 2015 Mar 20;290(12):7973-9. doi: 10.1074/jbc.M114.622738. Epub 2015 Feb 3.

Backbone

• Vector backbone: pRSFDuet-1 Ek/LIK
• Total vector size (bp): 8379
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Human MCM5
• Alt name: minichromosome maintenance 5
• Alt name: DNA replication licensing factor
• Species: H. sapiens (human)
• Insert Size (bp): 2246
• GenBank ID: NP_006730.2
• Entrez Gene: MCM5 (a.k.a. CDC46, MGORS8, P1-CDC46)
• Tag / Fusion Protein:
  • His6 (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: gacgacgacaagatgtcgggattcgacgatcctggc
• 3′ sequencing primer: cgcgggcggccgtcacttgaggcggtagagaaccttgc

Gene/Insert 2

• Gene/Insert name: human MCM3
• Alt name: minichromosome maintenance 3
• Alt name: DNA replication licensing factor
• Species: H. sapiens (human)
• Insert Size (bp): 2447
• GenBank ID: P25205.3
• Entrez Gene: MCM3 (a.k.a. HCC5, P1-MCM3, P1.h, RLFB)

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: gcgggcccggccttcatggcgggtaccgtggtgctggac
• 3′ sequencing primer: gaggagaagcccggtcagatgaggaagatgatgccctcag

Resource Information

• Supplemental Documents:
  • pRSF-hMCM3_5.gb
• A portion of this plasmid was derived from a plasmid made by: Juan Mendez, CISC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that mutation T194S in human MCM5 was found during Addgene's quality control. The depositor noted that this mutation does NOT affect plasmid function.