pET32-MCM2/7
(Plasmid #116949)

• Purpose: Expresses human MCM2 and human MCM7
• Depositing Lab: James Chong
• Publication: Hesketh et al J Biol Chem. 2015 Mar 20;290(12):7973-9. doi: 10.1074/jbc.M114.622738. Epub 2015 Feb 3.

Backbone

• Vector backbone: pET-32 Ek/LIK
• Total vector size (bp): 10930
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Human MCM7
• Alt name: minichromosome maintenance 7
• Alt name: CDC47
• Alt name: DNA replication licensing factor
• Species: H. sapiens (human)
• Insert Size (bp): 2633
• GenBank ID: NP_005907.3 P33993.4
• Entrez Gene: MCM7 (a.k.a. CDC47, MCM2, P1.1-MCM3, P1CDC47, P85MCM, PNAS146, PPP1R104)
• Tag / Fusion Protein:
  • Thioredoxin, His6

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: gacgacgacaagatggcactgaaggactacgcgctag
• 3′ sequencing primer: cgcgggcggccgtcagacaaaagtgatccgtgtccggg

Gene/Insert 2

• Gene/Insert name: Human MCM2
• Alt name: minichromosome maintenance 2
• Alt name: DNA replication licensing factor
• Species: H. sapiens (human)
• Insert Size (bp): 2735
• GenBank ID: NP_004517.2
• Entrez Gene: MCM2 (a.k.a. BM28, CCNL1, CDCL1, D3S3194, DFNA70, MITOTIN, cdc19)

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: gcgggcccggcctccatggcggaatcatcggaatccttcacc
• 3′ sequencing primer: gaggagaagcccggtcagaactgctgcaggatcattttcc

Resource Information

• Supplemental Documents:
  • pET32-MCM2_7.gb
• A portion of this plasmid was derived from a plasmid made by: Juan Mendez CISC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry