pFGL1169R
(Plasmid
#116899)
-
PurposeCenpC:mCherry (centromere marker)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 116899 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFGL822
-
Backbone manufacturerNaweed Lab
- Backbone size w/o insert (bp) 7779
- Total vector size (bp) 9989
-
Modifications to backboneinsertion with (truncated) CenpC-mCherry
-
Vector typeFungal expression (in Magnaporthe oryzae)
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCenp C (partial)
-
SpeciesMagnaporthe oryzae
-
Insert Size (bp)562
-
Mutationtruncated, no stop codon
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR I (not destroyed)
- 3′ cloning site Kpn I (not destroyed)
- 5′ sequencing primer CCGGAATTCGAGGACGAAGAACC
- 3′ sequencing primer GATGGTACCGCTGCTTTCAGTCATTTCGTCC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)720
-
Mutationwithout start codon
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site Kpn I (not destroyed)
- 3′ cloning site BamH I (not destroyed)
- 5′ sequencing primer CTCGGTACCGTGAGCAAGGGCGAGGAGGATAA
- 3′ sequencing primer CGCGGATCCTTACTTGTACAGCTCGTCCATGC (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameCenpC downstream region
-
SpeciesMagnaporthe oryzea
-
Insert Size (bp)981
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site Pst I (not destroyed)
- 3′ cloning site Hind III (not destroyed)
- 5′ sequencing primer CTGCTGCAGTAATTCATCGCGGTGGGTTGGTC
- 3′ sequencing primer TGTAAGCTTCTGGCCCTCCCTCATTAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFGL1169R was a gift from Naweed Naqvi (Addgene plasmid # 116899 ; http://n2t.net/addgene:116899 ; RRID:Addgene_116899) -
For your References section:
Cellular Dynamics and Genomic Identity of Centromeres in Cereal Blast Fungus. Yadav V, Yang F, Reza MH, Liu S, Valent B, Sanyal K, Naqvi NI. MBio. 2019 Jul 30;10(4). pii: mBio.01581-19. doi: 10.1128/mBio.01581-19. 10.1128/mBio.01581-19 PubMed 31363034