pMJA285= pSin-TCRab-CMVp-Puro
(Plasmid
#116875)
-
Purposestable TCR expression in human T cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 116875 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSin-EF2-Nanog-Pur
-
Backbone manufacturerJames Thomson Lab
- Backbone size w/o insert (bp) 6739
- Total vector size (bp) 10035
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTCR
-
Alt nameTCR alpha beta
-
Alt namebidirectional CMV Promoter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3294
-
Mutationdeletion of EF1-a promotor
-
GenBank IDMH782473
-
Entrez GeneTRAV10 (a.k.a. TCRAV10S1, TCRAV24S1)
-
Entrez GeneTRBV25-1 (a.k.a. TCRBV11S1A1T, TCRBV25S1, TRBV251)
- Promoter CMV Promotor
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (unknown if destroyed)
- 3′ cloning site Xbal (unknown if destroyed)
- 5′ sequencing primer MJA424 5’TTGCGTGCCTTGAATTACTTCCACCT
- 3′ sequencing primer MJA425 5’AATAAGGCCGGTGTGCGTTTGTCTAT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byRonja Pscheid, Rui Wang, Marcos Alcocer
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The psPAX2 packaging plasmid and pMD2.G envelope plasmid can be used with this vector.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMJA285= pSin-TCRab-CMVp-Puro was a gift from Marcos Alcocer (Addgene plasmid # 116875 ; http://n2t.net/addgene:116875 ; RRID:Addgene_116875) -
For your References section:
Towards a surrogate system to express human lipid binding TCRs. Wang R, Pscheid R, Ghumra A, Kan LYL, Cochrane S, Fairclough L, Alcocer MJC. Biotechnol Lett. 2019 Oct;41(10):1095-1104. doi: 10.1007/s10529-019-02713-2. Epub 2019 Jul 26. 10.1007/s10529-019-02713-2 PubMed 31346817