pPRIME-CMV-LNGFR-FF3
(Plasmid #11666)

• Purpose: 3rd generation lentiviral transfer vector. pPRIME cloning plasmid with a CMV promoter controlling expression of LNGFR and miR30-based shRNA targeting firefly luciferase
• Depositing Lab: Stephen Elledge
• Publication: Stegmeier et al Proc Natl Acad Sci U S A. 2005 Sep 13. 102(37):13212-7.

Backbone

• Vector backbone: pPRIME-CMV-LNGFR
• Backbone size w/o insert (bp): 8620
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: FF3
• Alt name: firefly luciferase hairpin
• Species: Firefly
• Insert Size (bp): 120
• Tag / Fusion Protein:
  • LNGFR (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: na

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

CMV promoter transcribes LNGFR (low affinity nerve growth factor receptor) and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site.

Please note that the full plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC)